Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\cpanrun-5.8\build\5-8-0\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t\parser.t t\pod-coverage.t t\pod.t
t\parser..........1..11
ok 1 - require Bio::GenBankParser;

              Warning: Undefined (sub)rule "source_line" used in a production.

              Warning: Undefined (sub)rule "organism" used in a production.

              Warning: Undefined (sub)rule "reference" used in a production.

              Warning: Undefined (sub)rule "features" used in a production.

              Warning: Undefined (sub)rule "origin" used in a production.

              Warning: Undefined (sub)rule "comment" used in a production.

              Warning: Undefined (sub)rule "record_delimiter" used in a
                       production.

              Warning: Undefined (sub)rule "eofile" used in a production.

       ERROR (line 5): Invalid section: Was expecting header, or locus, or
                       definition, or accession line, or version line, or
                       keywords, or source line, or organism, or reference, or
                       features, or origin, or comment, or record delimiter

       ERROR (line 5): Invalid startrule: Was expecting eofile but found
                       "KEYWORDS ." instead
#     Failed test (t\parser.t at line 25)
#          got: undef
#     expected: 'AB000001'
not ok 2 - Accession
#     Failed test (t\parser.t at line 26)
not ok 3 - Definition
#          got: undef
#     expected: 'Rhizoctonia solani genes for 18S rRNA, 5.8S rRNA, 28S rRNA, partial and complete sequence, isolate:#1.'
#     Failed test (t\parser.t at line 31)
#          got: undef
#     expected: 'Rhizoctonia solani'
#     Failed test (t\parser.t at line 32)
#          got: undef
#     expected: 'Rhizoctonia solani'
#     Failed test (t\parser.t at line 34)
#          got: undef
#     expected: 'ARRAY(0x20676c4)'
#     Failed test (t\parser.t at line 50)
#          got: undef
#     expected: 'HASH(0x20676c4)'
#     Failed test (t\parser.t at line 62)
#          got: undef
#     expected: 'ARRAY(0x20676c4)'
#     Failed test (t\parser.t at line 64)
#          got: undef
#     expected: 'ARRAY(0x20676c4)'
#     Failed test (t\parser.t at line 66)
#          got: undef
#     expected: 'ARRAY(0x2075e8c)'
#     Failed test (t\parser.t at line 107)
#          got: undef
#     expected: 'aattttaatgaagagtttggttgtagctggcccattaatttaggcatgtgcacacctttctctttcatcccatacacacctgtgaacttgtgagacagatggggaatttatttattgtttttttttgtaatataaagatgataagtcattgaacccttctgtctactcaactcatataaactcaatttattttaaaatgaatgtaatggatgtaacgcatctaatactaagtttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccttggagcatgcctgtttgagtatcatgaaatcttcaaaatcaagtcttttgttaattcaattggctttgactttggtattggaggtctttgcagcttcacacctgctcctctttgtacattagctggatctcagtgttatgcttggttccactcagcgtgataagttatctatcgctgaggacactgtaaaaaggtggccaaggtaaatgcagatgaaccgcttctaatagtccattgacttggacaatatttttatgatctgatctcaaatcaggtaggactacccgctgaacttaagcata'
# Looks like you failed 10 tests of 11.
not ok 4 - Organism
not ok 5 - Source
not ok 6 - Classification
not ok 7 - Locus
not ok 8 - Keywords
not ok 9 - Version
not ok 10 - References
not ok 11 - Sequence (Origin)
dubious
	Test returned status 10 (wstat 2560, 0xa00)
DIED. FAILED tests 2-11
	Failed 10/11 tests, 9.09% okay
t\pod-coverage....1..0 # Skip Pod::Coverage 0.18 required for testing POD coverage
skipped
        all skipped: Pod::Coverage 0.18 required for testing POD coverage
t\pod.............1..1
ok 1 - blib\lib\Bio\GenBankParser.pm
ok
Failed 1/3 test scripts, 66.67% okay. 10/12 subtests failed, 16.67% okay.
Failed Test Stat Wstat Total Fail  Failed  List of Failed
-------------------------------------------------------------------------------
t\parser.t    10  2560    11   10  90.91%  2-11
1 test skipped.
NMAKE : fatal error U1077: 'C:\cpanrun-5.8\build\5-8-0\bin\perl.exe' : return code '0xff'
Stop.